ID: 980483211

View in Genome Browser
Species Human (GRCh38)
Location 4:133416698-133416720
Sequence AAGTCCTCACCATTGCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980483211_980483214 26 Left 980483211 4:133416698-133416720 CCCAGGAGCAATGGTGAGGACTT No data
Right 980483214 4:133416747-133416769 AAAGAAAGCAGAAGTAGATAAGG No data
980483211_980483213 -2 Left 980483211 4:133416698-133416720 CCCAGGAGCAATGGTGAGGACTT No data
Right 980483213 4:133416719-133416741 TTGCACTAGAGTATCTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980483211 Original CRISPR AAGTCCTCACCATTGCTCCT GGG (reversed) Intergenic