ID: 980483212

View in Genome Browser
Species Human (GRCh38)
Location 4:133416699-133416721
Sequence CAAGTCCTCACCATTGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980483212_980483214 25 Left 980483212 4:133416699-133416721 CCAGGAGCAATGGTGAGGACTTG No data
Right 980483214 4:133416747-133416769 AAAGAAAGCAGAAGTAGATAAGG No data
980483212_980483213 -3 Left 980483212 4:133416699-133416721 CCAGGAGCAATGGTGAGGACTTG No data
Right 980483213 4:133416719-133416741 TTGCACTAGAGTATCTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980483212 Original CRISPR CAAGTCCTCACCATTGCTCC TGG (reversed) Intergenic
No off target data available for this crispr