ID: 980483213

View in Genome Browser
Species Human (GRCh38)
Location 4:133416719-133416741
Sequence TTGCACTAGAGTATCTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980483212_980483213 -3 Left 980483212 4:133416699-133416721 CCAGGAGCAATGGTGAGGACTTG No data
Right 980483213 4:133416719-133416741 TTGCACTAGAGTATCTGTAGAGG No data
980483206_980483213 28 Left 980483206 4:133416668-133416690 CCATTCAGGTAGTTACACGGTAT No data
Right 980483213 4:133416719-133416741 TTGCACTAGAGTATCTGTAGAGG No data
980483211_980483213 -2 Left 980483211 4:133416698-133416720 CCCAGGAGCAATGGTGAGGACTT No data
Right 980483213 4:133416719-133416741 TTGCACTAGAGTATCTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980483213 Original CRISPR TTGCACTAGAGTATCTGTAG AGG Intergenic
No off target data available for this crispr