ID: 980483214

View in Genome Browser
Species Human (GRCh38)
Location 4:133416747-133416769
Sequence AAAGAAAGCAGAAGTAGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980483212_980483214 25 Left 980483212 4:133416699-133416721 CCAGGAGCAATGGTGAGGACTTG No data
Right 980483214 4:133416747-133416769 AAAGAAAGCAGAAGTAGATAAGG No data
980483211_980483214 26 Left 980483211 4:133416698-133416720 CCCAGGAGCAATGGTGAGGACTT No data
Right 980483214 4:133416747-133416769 AAAGAAAGCAGAAGTAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980483214 Original CRISPR AAAGAAAGCAGAAGTAGATA AGG Intergenic