ID: 980483338

View in Genome Browser
Species Human (GRCh38)
Location 4:133419211-133419233
Sequence ATGCTGTTATAGATGTAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980483334_980483338 12 Left 980483334 4:133419176-133419198 CCTTTACACAAACTAATTTTCTC No data
Right 980483338 4:133419211-133419233 ATGCTGTTATAGATGTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980483338 Original CRISPR ATGCTGTTATAGATGTAAAG AGG Intergenic
No off target data available for this crispr