ID: 980486179

View in Genome Browser
Species Human (GRCh38)
Location 4:133460566-133460588
Sequence TTTCAGCCCCAAGAATTGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980486178_980486179 -4 Left 980486178 4:133460547-133460569 CCTGCAGAAAGCTCTAAATTTTC No data
Right 980486179 4:133460566-133460588 TTTCAGCCCCAAGAATTGCGTGG No data
980486176_980486179 26 Left 980486176 4:133460517-133460539 CCTTTTGGGAATGAAGGACCATA No data
Right 980486179 4:133460566-133460588 TTTCAGCCCCAAGAATTGCGTGG No data
980486177_980486179 8 Left 980486177 4:133460535-133460557 CCATAAATGCTGCCTGCAGAAAG No data
Right 980486179 4:133460566-133460588 TTTCAGCCCCAAGAATTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980486179 Original CRISPR TTTCAGCCCCAAGAATTGCG TGG Intergenic
No off target data available for this crispr