ID: 980486302

View in Genome Browser
Species Human (GRCh38)
Location 4:133461661-133461683
Sequence ATGGTCCACTTTAATATCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980486298_980486302 0 Left 980486298 4:133461638-133461660 CCTTTTTCTGACCTCCTGCTCAT No data
Right 980486302 4:133461661-133461683 ATGGTCCACTTTAATATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980486302 Original CRISPR ATGGTCCACTTTAATATCTG AGG Intergenic
No off target data available for this crispr