ID: 980497173

View in Genome Browser
Species Human (GRCh38)
Location 4:133601079-133601101
Sequence AATTCAACCCCCAATGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980497173_980497177 -5 Left 980497173 4:133601079-133601101 CCAAACCCATTGGGGGTTGAATT No data
Right 980497177 4:133601097-133601119 GAATTTCCATTACTGGCGAATGG No data
980497173_980497181 12 Left 980497173 4:133601079-133601101 CCAAACCCATTGGGGGTTGAATT No data
Right 980497181 4:133601114-133601136 GAATGGATTCTAGGAGAGCTGGG No data
980497173_980497179 3 Left 980497173 4:133601079-133601101 CCAAACCCATTGGGGGTTGAATT No data
Right 980497179 4:133601105-133601127 ATTACTGGCGAATGGATTCTAGG No data
980497173_980497180 11 Left 980497173 4:133601079-133601101 CCAAACCCATTGGGGGTTGAATT No data
Right 980497180 4:133601113-133601135 CGAATGGATTCTAGGAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980497173 Original CRISPR AATTCAACCCCCAATGGGTT TGG (reversed) Intergenic
No off target data available for this crispr