ID: 980497177

View in Genome Browser
Species Human (GRCh38)
Location 4:133601097-133601119
Sequence GAATTTCCATTACTGGCGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980497172_980497177 -4 Left 980497172 4:133601078-133601100 CCCAAACCCATTGGGGGTTGAAT No data
Right 980497177 4:133601097-133601119 GAATTTCCATTACTGGCGAATGG No data
980497173_980497177 -5 Left 980497173 4:133601079-133601101 CCAAACCCATTGGGGGTTGAATT No data
Right 980497177 4:133601097-133601119 GAATTTCCATTACTGGCGAATGG No data
980497174_980497177 -10 Left 980497174 4:133601084-133601106 CCCATTGGGGGTTGAATTTCCAT No data
Right 980497177 4:133601097-133601119 GAATTTCCATTACTGGCGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980497177 Original CRISPR GAATTTCCATTACTGGCGAA TGG Intergenic
No off target data available for this crispr