ID: 980497181

View in Genome Browser
Species Human (GRCh38)
Location 4:133601114-133601136
Sequence GAATGGATTCTAGGAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980497174_980497181 7 Left 980497174 4:133601084-133601106 CCCATTGGGGGTTGAATTTCCAT No data
Right 980497181 4:133601114-133601136 GAATGGATTCTAGGAGAGCTGGG No data
980497175_980497181 6 Left 980497175 4:133601085-133601107 CCATTGGGGGTTGAATTTCCATT No data
Right 980497181 4:133601114-133601136 GAATGGATTCTAGGAGAGCTGGG No data
980497172_980497181 13 Left 980497172 4:133601078-133601100 CCCAAACCCATTGGGGGTTGAAT No data
Right 980497181 4:133601114-133601136 GAATGGATTCTAGGAGAGCTGGG No data
980497173_980497181 12 Left 980497173 4:133601079-133601101 CCAAACCCATTGGGGGTTGAATT No data
Right 980497181 4:133601114-133601136 GAATGGATTCTAGGAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980497181 Original CRISPR GAATGGATTCTAGGAGAGCT GGG Intergenic
No off target data available for this crispr