ID: 980497254

View in Genome Browser
Species Human (GRCh38)
Location 4:133602477-133602499
Sequence CTCTAATATCAGTATTTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980497254_980497255 1 Left 980497254 4:133602477-133602499 CCTTGTAAATACTGATATTAGAG No data
Right 980497255 4:133602501-133602523 TGAATAATTATAAAAGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980497254 Original CRISPR CTCTAATATCAGTATTTACA AGG (reversed) Intergenic
No off target data available for this crispr