ID: 980497526

View in Genome Browser
Species Human (GRCh38)
Location 4:133605354-133605376
Sequence GACAGCTCTTGGCCTGTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980497526_980497529 16 Left 980497526 4:133605354-133605376 CCAATAACAGGCCAAGAGCTGTC No data
Right 980497529 4:133605393-133605415 GTTATCTACAGAAGATTACAGGG No data
980497526_980497528 15 Left 980497526 4:133605354-133605376 CCAATAACAGGCCAAGAGCTGTC No data
Right 980497528 4:133605392-133605414 AGTTATCTACAGAAGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980497526 Original CRISPR GACAGCTCTTGGCCTGTTAT TGG (reversed) Intergenic
No off target data available for this crispr