ID: 980497528

View in Genome Browser
Species Human (GRCh38)
Location 4:133605392-133605414
Sequence AGTTATCTACAGAAGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980497525_980497528 16 Left 980497525 4:133605353-133605375 CCCAATAACAGGCCAAGAGCTGT No data
Right 980497528 4:133605392-133605414 AGTTATCTACAGAAGATTACAGG No data
980497527_980497528 4 Left 980497527 4:133605365-133605387 CCAAGAGCTGTCTCTCAAAAAGA No data
Right 980497528 4:133605392-133605414 AGTTATCTACAGAAGATTACAGG No data
980497524_980497528 22 Left 980497524 4:133605347-133605369 CCAAAGCCCAATAACAGGCCAAG No data
Right 980497528 4:133605392-133605414 AGTTATCTACAGAAGATTACAGG No data
980497526_980497528 15 Left 980497526 4:133605354-133605376 CCAATAACAGGCCAAGAGCTGTC No data
Right 980497528 4:133605392-133605414 AGTTATCTACAGAAGATTACAGG No data
980497523_980497528 25 Left 980497523 4:133605344-133605366 CCACCAAAGCCCAATAACAGGCC No data
Right 980497528 4:133605392-133605414 AGTTATCTACAGAAGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980497528 Original CRISPR AGTTATCTACAGAAGATTAC AGG Intergenic
No off target data available for this crispr