ID: 980502622

View in Genome Browser
Species Human (GRCh38)
Location 4:133675803-133675825
Sequence AATGACTATGAGAGTATTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980502618_980502622 15 Left 980502618 4:133675765-133675787 CCTAAAGATTAATTTCAATTTTA No data
Right 980502622 4:133675803-133675825 AATGACTATGAGAGTATTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980502622 Original CRISPR AATGACTATGAGAGTATTGG GGG Intergenic
No off target data available for this crispr