ID: 980513661

View in Genome Browser
Species Human (GRCh38)
Location 4:133825398-133825420
Sequence TAGTGGGTCATGAGGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980513661_980513670 21 Left 980513661 4:133825398-133825420 CCCTCACCCCTCATGACCCACTA No data
Right 980513670 4:133825442-133825464 CCTATGACATTACATTCTGCTGG No data
980513661_980513671 29 Left 980513661 4:133825398-133825420 CCCTCACCCCTCATGACCCACTA No data
Right 980513671 4:133825450-133825472 ATTACATTCTGCTGGCCTAGAGG 0: 59
1: 138
2: 171
3: 166
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980513661 Original CRISPR TAGTGGGTCATGAGGGGTGA GGG (reversed) Intergenic
No off target data available for this crispr