ID: 980516515

View in Genome Browser
Species Human (GRCh38)
Location 4:133869157-133869179
Sequence CACGTCCAGCTAATGTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980516515_980516522 18 Left 980516515 4:133869157-133869179 CCCCAAAACATTAGCTGGACGTG No data
Right 980516522 4:133869198-133869220 CCCAGCTACTTAGGAAGTTGAGG No data
980516515_980516519 9 Left 980516515 4:133869157-133869179 CCCCAAAACATTAGCTGGACGTG No data
Right 980516519 4:133869189-133869211 GCCTGTAGTCCCAGCTACTTAGG 0: 29903
1: 154936
2: 253675
3: 221513
4: 364385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980516515 Original CRISPR CACGTCCAGCTAATGTTTTG GGG (reversed) Intergenic
No off target data available for this crispr