ID: 980516800

View in Genome Browser
Species Human (GRCh38)
Location 4:133874527-133874549
Sequence TGGAATTAAAGGCATGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980516800_980516808 8 Left 980516800 4:133874527-133874549 CCAACCACATGCCTTTAATTCCA No data
Right 980516808 4:133874558-133874580 GAGGATCAGTAGGTTTGGGTTGG No data
980516800_980516807 4 Left 980516800 4:133874527-133874549 CCAACCACATGCCTTTAATTCCA No data
Right 980516807 4:133874554-133874576 CAAAGAGGATCAGTAGGTTTGGG No data
980516800_980516806 3 Left 980516800 4:133874527-133874549 CCAACCACATGCCTTTAATTCCA No data
Right 980516806 4:133874553-133874575 ACAAAGAGGATCAGTAGGTTTGG No data
980516800_980516805 -2 Left 980516800 4:133874527-133874549 CCAACCACATGCCTTTAATTCCA No data
Right 980516805 4:133874548-133874570 CAATTACAAAGAGGATCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980516800 Original CRISPR TGGAATTAAAGGCATGTGGT TGG (reversed) Intergenic
No off target data available for this crispr