ID: 980520846

View in Genome Browser
Species Human (GRCh38)
Location 4:133932014-133932036
Sequence CAGGGTAAACCAGGGGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980520846_980520857 11 Left 980520846 4:133932014-133932036 CCCACAGCCCCTGGTTTACCCTG No data
Right 980520857 4:133932048-133932070 AGCCCCATGTGGCTACTGCATGG No data
980520846_980520861 18 Left 980520846 4:133932014-133932036 CCCACAGCCCCTGGTTTACCCTG No data
Right 980520861 4:133932055-133932077 TGTGGCTACTGCATGGCATGTGG No data
980520846_980520854 0 Left 980520846 4:133932014-133932036 CCCACAGCCCCTGGTTTACCCTG No data
Right 980520854 4:133932037-133932059 TTCCCAAGGACAGCCCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980520846 Original CRISPR CAGGGTAAACCAGGGGCTGT GGG (reversed) Intergenic
No off target data available for this crispr