ID: 980524819

View in Genome Browser
Species Human (GRCh38)
Location 4:133976109-133976131
Sequence TGGGCTCTGTTGGGGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980524819_980524828 1 Left 980524819 4:133976109-133976131 CCACCTTCCCCCAACAGAGCCCA No data
Right 980524828 4:133976133-133976155 TTTGTGTTGTTCCTCTCCCTGGG No data
980524819_980524827 0 Left 980524819 4:133976109-133976131 CCACCTTCCCCCAACAGAGCCCA No data
Right 980524827 4:133976132-133976154 GTTTGTGTTGTTCCTCTCCCTGG No data
980524819_980524832 24 Left 980524819 4:133976109-133976131 CCACCTTCCCCCAACAGAGCCCA No data
Right 980524832 4:133976156-133976178 TCCATATGTTCTCATTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980524819 Original CRISPR TGGGCTCTGTTGGGGGAAGG TGG (reversed) Intergenic
No off target data available for this crispr