ID: 980524825

View in Genome Browser
Species Human (GRCh38)
Location 4:133976128-133976150
Sequence GGAGAGGAACAACACAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980524825_980524832 5 Left 980524825 4:133976128-133976150 CCCAGTTTGTGTTGTTCCTCTCC No data
Right 980524832 4:133976156-133976178 TCCATATGTTCTCATTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980524825 Original CRISPR GGAGAGGAACAACACAAACT GGG (reversed) Intergenic
No off target data available for this crispr