ID: 980524826

View in Genome Browser
Species Human (GRCh38)
Location 4:133976129-133976151
Sequence GGGAGAGGAACAACACAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980524826_980524832 4 Left 980524826 4:133976129-133976151 CCAGTTTGTGTTGTTCCTCTCCC No data
Right 980524832 4:133976156-133976178 TCCATATGTTCTCATTGTTCAGG No data
980524826_980524834 30 Left 980524826 4:133976129-133976151 CCAGTTTGTGTTGTTCCTCTCCC No data
Right 980524834 4:133976182-133976204 TACTTATAAGTGAGAATATGTGG 0: 30
1: 542
2: 3574
3: 14784
4: 16220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980524826 Original CRISPR GGGAGAGGAACAACACAAAC TGG (reversed) Intergenic
No off target data available for this crispr