ID: 980524828

View in Genome Browser
Species Human (GRCh38)
Location 4:133976133-133976155
Sequence TTTGTGTTGTTCCTCTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980524815_980524828 18 Left 980524815 4:133976092-133976114 CCTGATGCTCTCCCCTGCCACCT No data
Right 980524828 4:133976133-133976155 TTTGTGTTGTTCCTCTCCCTGGG No data
980524820_980524828 -2 Left 980524820 4:133976112-133976134 CCTTCCCCCAACAGAGCCCAGTT No data
Right 980524828 4:133976133-133976155 TTTGTGTTGTTCCTCTCCCTGGG No data
980524824_980524828 -9 Left 980524824 4:133976119-133976141 CCAACAGAGCCCAGTTTGTGTTG No data
Right 980524828 4:133976133-133976155 TTTGTGTTGTTCCTCTCCCTGGG No data
980524821_980524828 -6 Left 980524821 4:133976116-133976138 CCCCCAACAGAGCCCAGTTTGTG No data
Right 980524828 4:133976133-133976155 TTTGTGTTGTTCCTCTCCCTGGG No data
980524818_980524828 5 Left 980524818 4:133976105-133976127 CCTGCCACCTTCCCCCAACAGAG No data
Right 980524828 4:133976133-133976155 TTTGTGTTGTTCCTCTCCCTGGG No data
980524819_980524828 1 Left 980524819 4:133976109-133976131 CCACCTTCCCCCAACAGAGCCCA No data
Right 980524828 4:133976133-133976155 TTTGTGTTGTTCCTCTCCCTGGG No data
980524817_980524828 6 Left 980524817 4:133976104-133976126 CCCTGCCACCTTCCCCCAACAGA No data
Right 980524828 4:133976133-133976155 TTTGTGTTGTTCCTCTCCCTGGG No data
980524822_980524828 -7 Left 980524822 4:133976117-133976139 CCCCAACAGAGCCCAGTTTGTGT No data
Right 980524828 4:133976133-133976155 TTTGTGTTGTTCCTCTCCCTGGG No data
980524816_980524828 7 Left 980524816 4:133976103-133976125 CCCCTGCCACCTTCCCCCAACAG No data
Right 980524828 4:133976133-133976155 TTTGTGTTGTTCCTCTCCCTGGG No data
980524823_980524828 -8 Left 980524823 4:133976118-133976140 CCCAACAGAGCCCAGTTTGTGTT No data
Right 980524828 4:133976133-133976155 TTTGTGTTGTTCCTCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980524828 Original CRISPR TTTGTGTTGTTCCTCTCCCT GGG Intergenic
No off target data available for this crispr