ID: 980524832

View in Genome Browser
Species Human (GRCh38)
Location 4:133976156-133976178
Sequence TCCATATGTTCTCATTGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980524819_980524832 24 Left 980524819 4:133976109-133976131 CCACCTTCCCCCAACAGAGCCCA No data
Right 980524832 4:133976156-133976178 TCCATATGTTCTCATTGTTCAGG No data
980524818_980524832 28 Left 980524818 4:133976105-133976127 CCTGCCACCTTCCCCCAACAGAG No data
Right 980524832 4:133976156-133976178 TCCATATGTTCTCATTGTTCAGG No data
980524823_980524832 15 Left 980524823 4:133976118-133976140 CCCAACAGAGCCCAGTTTGTGTT No data
Right 980524832 4:133976156-133976178 TCCATATGTTCTCATTGTTCAGG No data
980524817_980524832 29 Left 980524817 4:133976104-133976126 CCCTGCCACCTTCCCCCAACAGA No data
Right 980524832 4:133976156-133976178 TCCATATGTTCTCATTGTTCAGG No data
980524826_980524832 4 Left 980524826 4:133976129-133976151 CCAGTTTGTGTTGTTCCTCTCCC No data
Right 980524832 4:133976156-133976178 TCCATATGTTCTCATTGTTCAGG No data
980524821_980524832 17 Left 980524821 4:133976116-133976138 CCCCCAACAGAGCCCAGTTTGTG No data
Right 980524832 4:133976156-133976178 TCCATATGTTCTCATTGTTCAGG No data
980524825_980524832 5 Left 980524825 4:133976128-133976150 CCCAGTTTGTGTTGTTCCTCTCC No data
Right 980524832 4:133976156-133976178 TCCATATGTTCTCATTGTTCAGG No data
980524816_980524832 30 Left 980524816 4:133976103-133976125 CCCCTGCCACCTTCCCCCAACAG No data
Right 980524832 4:133976156-133976178 TCCATATGTTCTCATTGTTCAGG No data
980524824_980524832 14 Left 980524824 4:133976119-133976141 CCAACAGAGCCCAGTTTGTGTTG No data
Right 980524832 4:133976156-133976178 TCCATATGTTCTCATTGTTCAGG No data
980524822_980524832 16 Left 980524822 4:133976117-133976139 CCCCAACAGAGCCCAGTTTGTGT No data
Right 980524832 4:133976156-133976178 TCCATATGTTCTCATTGTTCAGG No data
980524820_980524832 21 Left 980524820 4:133976112-133976134 CCTTCCCCCAACAGAGCCCAGTT No data
Right 980524832 4:133976156-133976178 TCCATATGTTCTCATTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980524832 Original CRISPR TCCATATGTTCTCATTGTTC AGG Intergenic
No off target data available for this crispr