ID: 980538442

View in Genome Browser
Species Human (GRCh38)
Location 4:134160591-134160613
Sequence GGAGCCACCACATCTAGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980538442_980538446 4 Left 980538442 4:134160591-134160613 CCAAATCTAGATGTGGTGGCTCC No data
Right 980538446 4:134160618-134160640 TATAATCCCAGCTATTTGGGAGG 0: 216
1: 7846
2: 104204
3: 516854
4: 501979
980538442_980538444 0 Left 980538442 4:134160591-134160613 CCAAATCTAGATGTGGTGGCTCC No data
Right 980538444 4:134160614-134160636 TGTCTATAATCCCAGCTATTTGG 0: 11
1: 524
2: 11362
3: 94497
4: 261191
980538442_980538449 17 Left 980538442 4:134160591-134160613 CCAAATCTAGATGTGGTGGCTCC No data
Right 980538449 4:134160631-134160653 ATTTGGGAGGTTGATGTGAAAGG No data
980538442_980538450 27 Left 980538442 4:134160591-134160613 CCAAATCTAGATGTGGTGGCTCC No data
Right 980538450 4:134160641-134160663 TTGATGTGAAAGGATTGTTGAGG No data
980538442_980538445 1 Left 980538442 4:134160591-134160613 CCAAATCTAGATGTGGTGGCTCC No data
Right 980538445 4:134160615-134160637 GTCTATAATCCCAGCTATTTGGG 0: 8
1: 482
2: 10242
3: 107456
4: 489924

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980538442 Original CRISPR GGAGCCACCACATCTAGATT TGG (reversed) Intergenic
No off target data available for this crispr