ID: 980547846

View in Genome Browser
Species Human (GRCh38)
Location 4:134292749-134292771
Sequence GTGCCTGGGTGTACTAGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980547846_980547852 9 Left 980547846 4:134292749-134292771 CCTAATCTAGTACACCCAGGCAC No data
Right 980547852 4:134292781-134292803 TCCACCCCACCTCAAACCCCTGG No data
980547846_980547859 23 Left 980547846 4:134292749-134292771 CCTAATCTAGTACACCCAGGCAC No data
Right 980547859 4:134292795-134292817 AACCCCTGGTAACAGGCCTGTGG No data
980547846_980547857 16 Left 980547846 4:134292749-134292771 CCTAATCTAGTACACCCAGGCAC No data
Right 980547857 4:134292788-134292810 CACCTCAAACCCCTGGTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980547846 Original CRISPR GTGCCTGGGTGTACTAGATT AGG (reversed) Intergenic
No off target data available for this crispr