ID: 980550430

View in Genome Browser
Species Human (GRCh38)
Location 4:134327965-134327987
Sequence GTTTCCCGCCAATGGGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980550420_980550430 22 Left 980550420 4:134327920-134327942 CCGCGCGGTGGTGCCTATCACAG 0: 1
1: 0
2: 0
3: 4
4: 47
Right 980550430 4:134327965-134327987 GTTTCCCGCCAATGGGGAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 84
980550426_980550430 -10 Left 980550426 4:134327952-134327974 CCGAGGTGGATGAGTTTCCCGCC 0: 1
1: 2
2: 0
3: 4
4: 85
Right 980550430 4:134327965-134327987 GTTTCCCGCCAATGGGGAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 84
980550419_980550430 23 Left 980550419 4:134327919-134327941 CCCGCGCGGTGGTGCCTATCACA 0: 1
1: 0
2: 0
3: 2
4: 26
Right 980550430 4:134327965-134327987 GTTTCCCGCCAATGGGGAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 84
980550423_980550430 9 Left 980550423 4:134327933-134327955 CCTATCACAGAGGAAGAGGCCGA 0: 1
1: 0
2: 2
3: 43
4: 329
Right 980550430 4:134327965-134327987 GTTTCCCGCCAATGGGGAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 84
980550418_980550430 28 Left 980550418 4:134327914-134327936 CCTGGCCCGCGCGGTGGTGCCTA 0: 1
1: 0
2: 2
3: 3
4: 105
Right 980550430 4:134327965-134327987 GTTTCCCGCCAATGGGGAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980550430 Original CRISPR GTTTCCCGCCAATGGGGAGT TGG Intergenic
900363808 1:2302371-2302393 GTTTCCTTCCCATGGGGAGGGGG + Intronic
902953633 1:19908493-19908515 GTTTCCTGACAGTGGGGAGATGG + Exonic
905237283 1:36558808-36558830 CTTTCCCGCCACTGAGGAGGAGG - Intergenic
906770778 1:48480193-48480215 GTTTCTCGCAGAGGGGGAGTTGG - Intergenic
916771321 1:167911589-167911611 TGTTCCGGCCAATGGGCAGTAGG + Intronic
919221568 1:194636959-194636981 ATTTCCAGTCAATGGGGAATAGG + Intergenic
919994787 1:202739511-202739533 GTTTCTCGCAGAGGGGGAGTTGG + Intronic
921827451 1:219689033-219689055 GTTTCCTGGCAATGGGCAGTAGG - Intronic
923014905 1:230119364-230119386 GTTTCCTGCAAATGTGAAGTCGG + Intronic
923346065 1:233053693-233053715 TTTTCCCGCAAATGAGGAGCTGG - Intronic
923503979 1:234589893-234589915 CTTTCCCTGCAATTGGGAGTAGG - Intergenic
923546253 1:234925579-234925601 GTTTCCCATCAATGGTGAATTGG + Intergenic
924245859 1:242083954-242083976 ATTTTCCGCCCATGGGGAATAGG + Exonic
1067354733 10:45513182-45513204 GTTTCTCGCAGAGGGGGAGTTGG - Intronic
1068948182 10:62750343-62750365 TTTTCCTGCCTATGGGGAGATGG - Intergenic
1071250387 10:83812696-83812718 GTTTACTGTCAGTGGGGAGTGGG - Intergenic
1077330551 11:1982219-1982241 ATATCCCGCCCATGGGGAGTTGG + Intronic
1089184060 11:116602968-116602990 GTTTCCTGGAAATAGGGAGTTGG - Intergenic
1090152707 11:124402866-124402888 GTTTCTCGCAGATGGGGATTTGG + Intergenic
1202813529 11_KI270721v1_random:37398-37420 ATATCCCGCCCATGGGGAGTTGG + Intergenic
1097127689 12:56788493-56788515 GTTTCTCGCAGATGGGGATTTGG + Intergenic
1098853210 12:75622720-75622742 CTTTCCCTCCAAAGTGGAGTAGG - Intergenic
1101789130 12:107911989-107912011 GTTTCCCGCCACTGAAGAGGAGG - Intergenic
1101959722 12:109239762-109239784 GTTTCCAGCCAGCTGGGAGTAGG + Intronic
1102909950 12:116705687-116705709 GTTGCACGCCACTGCGGAGTTGG - Intergenic
1105871246 13:24507476-24507498 GTCTCCAGCCAAGGGGGAGAGGG - Intronic
1108514505 13:51187401-51187423 ATTTCCCGCAAATTGGTAGTTGG - Intergenic
1113094677 13:106651044-106651066 GTTCCCTGCCTATGGGGAGCGGG - Intergenic
1113494463 13:110715777-110715799 GCCTCCAGCCAATGGGGAGGAGG - Exonic
1119594715 14:75924320-75924342 GTTTCTCGCAGAGGGGGAGTTGG + Intronic
1121183422 14:91946731-91946753 GTTTCAAGCCAATGAGAAGTGGG - Intronic
1127262948 15:57339101-57339123 GTTTCAGGCCCATGGGGTGTGGG - Intergenic
1127782728 15:62331611-62331633 GTTTCTCGCAGAGGGGGAGTTGG + Intergenic
1127874452 15:63099736-63099758 GTTTCTCGCAGAGGGGGAGTTGG - Intergenic
1128237361 15:66077429-66077451 GCTTCTCACCTATGGGGAGTAGG - Intronic
1128489504 15:68133771-68133793 GTTTCTCGCAGAGGGGGAGTTGG + Intronic
1128726160 15:69990056-69990078 GCATGCAGCCAATGGGGAGTTGG - Intergenic
1128748503 15:70131893-70131915 GTGTCCAGCCGATGGGGATTAGG + Intergenic
1132300634 15:100773599-100773621 GTTTCCCGCAGAGGGGGATTTGG + Intergenic
1138382124 16:56609839-56609861 GATTCCAGCCACTGGGGAGTTGG - Intergenic
1138642016 16:58395366-58395388 GTTTCTCGCAAAGGGGGATTTGG + Intronic
1144450144 17:15370388-15370410 TTTTTCCACGAATGGGGAGTGGG + Intergenic
1145721739 17:27079699-27079721 GTTACTCGTCTATGGGGAGTTGG + Intergenic
1145896316 17:28459722-28459744 GTTTCTCGCAAAGGGGGATTTGG - Intronic
1152543256 17:80987741-80987763 GTTTCCTGCCAATGGGAAACGGG + Intergenic
1160827513 19:1087549-1087571 GGTTCCCGGGACTGGGGAGTTGG - Exonic
1163906321 19:20152070-20152092 GTTTCTCGCAAAGGGGGATTTGG + Intergenic
1168280447 19:55302685-55302707 GTTTCCCGCCTCTGGGGAAGTGG - Exonic
927464889 2:23329450-23329472 GTTTGCCAACAATGGGGATTGGG - Intergenic
932834535 2:75023830-75023852 CGTTCCAGCCAATGGAGAGTTGG + Intergenic
938828684 2:135032650-135032672 GTTTCTCGCAGAGGGGGAGTTGG + Intronic
940829994 2:158456827-158456849 CCTTCCCGCCAATGGGGTGGCGG + Intergenic
944815410 2:203371965-203371987 GTTTCTCGCAGAGGGGGAGTTGG + Intronic
947621161 2:231592111-231592133 GTTTCCCAGCAGTGGTGAGTAGG - Intergenic
1170592293 20:17779820-17779842 GTTTCCCGCAGAGGGGGATTTGG - Intergenic
1172257857 20:33535706-33535728 GTTTCTCGCAGAGGGGGAGTTGG + Intronic
1173439946 20:43067302-43067324 GTTGCCAGGGAATGGGGAGTGGG + Intronic
1173661533 20:44737713-44737735 GGTACCCACCAATGAGGAGTGGG - Intergenic
1174872564 20:54196645-54196667 GTTCCCCCCCTTTGGGGAGTGGG + Intergenic
1179643611 21:42762298-42762320 GCTTCCAGCCAATGGAGAGTGGG - Intronic
1180011577 21:45054825-45054847 GTTTCCCTCCCAGCGGGAGTGGG - Intergenic
1184854246 22:47137795-47137817 GGTCCCTGCCAGTGGGGAGTCGG + Intronic
956902003 3:73726711-73726733 GTTTCCTGCCTCTGGGAAGTTGG + Intergenic
961675587 3:128563666-128563688 GTTTCCAGGCAGTGGGGAGCAGG - Intergenic
964883585 3:161452800-161452822 GTTTCCCGCCTACGTGGAGCTGG - Intergenic
972354503 4:38267693-38267715 GTGTCCAGCCAATAGAGAGTGGG - Intergenic
973675001 4:53255249-53255271 GTTTCTCGCAGAGGGGGAGTTGG + Intronic
979192120 4:117874506-117874528 TTTTCCCTCCAATGGGAAGCTGG - Intergenic
980550430 4:134327965-134327987 GTTTCCCGCCAATGGGGAGTTGG + Intergenic
981467210 4:145086933-145086955 GTATCCCTCCCATGGAGAGTGGG - Intronic
982218804 4:153107276-153107298 GTTTCCAGGCAGTGGGCAGTGGG + Intergenic
982255567 4:153448136-153448158 GCTTCCTGCTAATGGGGAGACGG - Intergenic
987036382 5:14023196-14023218 GTTTCCTGCCAATGAAGAGGAGG + Intergenic
992009085 5:72509333-72509355 GTTTCCTGCCTGTGAGGAGTTGG - Intergenic
996968162 5:129330784-129330806 GTTTCCTTGCAATGGGGAGAGGG + Intergenic
997661369 5:135591673-135591695 GATCCCAGCCAATGGGGAGTGGG + Intergenic
998067719 5:139171658-139171680 GTTTCTCGCAGAGGGGGAGTTGG - Intronic
998401434 5:141850850-141850872 GTGTCCCGCCCATGGGGTTTCGG - Intergenic
999151742 5:149430767-149430789 GTTGCCCCCCAATGGGGCCTCGG + Intergenic
1002057928 5:176609618-176609640 GCTTCCCGCCACTGGGGGGAGGG - Intronic
1012983414 6:105853142-105853164 GTTTCTCGCAGAGGGGGAGTTGG + Intergenic
1013204950 6:107935747-107935769 GTTTCTCGCAGAGGGGGAGTTGG - Intronic
1019579429 7:1753002-1753024 GTTTCCCCCAGATGGGGTGTAGG + Intergenic
1023963222 7:44945163-44945185 GTTTCCAGCGAATAGGGACTGGG + Intergenic
1030350255 7:108476966-108476988 GTTGCCAGACACTGGGGAGTAGG + Intronic
1039152972 8:34528025-34528047 GTTTCTCGCAGAGGGGGAGTTGG + Intergenic
1041410074 8:57543895-57543917 GTTTGCAGCCAATGGGGATCAGG - Intergenic
1059014696 9:110503435-110503457 GTTTCCCACCTATGGGCAGAGGG - Intronic
1061396271 9:130345649-130345671 GTATCCCCACAGTGGGGAGTGGG + Intronic
1189324345 X:40104006-40104028 GAGCCCCGCCAATGGGGGGTGGG - Intronic
1201335925 Y:12879509-12879531 GTTTCTCGCAAAGGGGGATTTGG - Intergenic