ID: 980559343

View in Genome Browser
Species Human (GRCh38)
Location 4:134452397-134452419
Sequence TCTTTGTTCTACTGGGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980559340_980559343 -6 Left 980559340 4:134452380-134452402 CCAAACTGGAAGAATGTTCTTTG No data
Right 980559343 4:134452397-134452419 TCTTTGTTCTACTGGGAAACAGG No data
980559339_980559343 -5 Left 980559339 4:134452379-134452401 CCCAAACTGGAAGAATGTTCTTT No data
Right 980559343 4:134452397-134452419 TCTTTGTTCTACTGGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980559343 Original CRISPR TCTTTGTTCTACTGGGAAAC AGG Intergenic
No off target data available for this crispr