ID: 980563480

View in Genome Browser
Species Human (GRCh38)
Location 4:134507286-134507308
Sequence GAGGATTATCCCCTCTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980563480_980563482 -8 Left 980563480 4:134507286-134507308 CCTCTCAAGAGGGGATAATCCTC No data
Right 980563482 4:134507301-134507323 TAATCCTCATCCCCAAGGAGTGG No data
980563480_980563488 14 Left 980563480 4:134507286-134507308 CCTCTCAAGAGGGGATAATCCTC No data
Right 980563488 4:134507323-134507345 GGCACTCATAATTTCTGCCTAGG No data
980563480_980563483 -7 Left 980563480 4:134507286-134507308 CCTCTCAAGAGGGGATAATCCTC No data
Right 980563483 4:134507302-134507324 AATCCTCATCCCCAAGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980563480 Original CRISPR GAGGATTATCCCCTCTTGAG AGG (reversed) Intergenic
No off target data available for this crispr