ID: 980564036

View in Genome Browser
Species Human (GRCh38)
Location 4:134514808-134514830
Sequence GTGGAGCAAATAGGAAATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980564033_980564036 28 Left 980564033 4:134514757-134514779 CCAAAAATTGGTAAATAAGATTT No data
Right 980564036 4:134514808-134514830 GTGGAGCAAATAGGAAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980564036 Original CRISPR GTGGAGCAAATAGGAAATAC AGG Intergenic
No off target data available for this crispr