ID: 980564327

View in Genome Browser
Species Human (GRCh38)
Location 4:134518883-134518905
Sequence CTTTGGTGGGCACGGGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980564327_980564338 11 Left 980564327 4:134518883-134518905 CCCCAGCCCCGTGCCCACCAAAG No data
Right 980564338 4:134518917-134518939 ATTCCTAGCTTCTGAATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980564327 Original CRISPR CTTTGGTGGGCACGGGGCTG GGG (reversed) Intergenic
No off target data available for this crispr