ID: 980564328

View in Genome Browser
Species Human (GRCh38)
Location 4:134518884-134518906
Sequence ACTTTGGTGGGCACGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980564328_980564338 10 Left 980564328 4:134518884-134518906 CCCAGCCCCGTGCCCACCAAAGT No data
Right 980564338 4:134518917-134518939 ATTCCTAGCTTCTGAATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980564328 Original CRISPR ACTTTGGTGGGCACGGGGCT GGG (reversed) Intergenic
No off target data available for this crispr