ID: 980564330

View in Genome Browser
Species Human (GRCh38)
Location 4:134518889-134518911
Sequence AGGGCACTTTGGTGGGCACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980564330_980564338 5 Left 980564330 4:134518889-134518911 CCCCGTGCCCACCAAAGTGCCCT No data
Right 980564338 4:134518917-134518939 ATTCCTAGCTTCTGAATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980564330 Original CRISPR AGGGCACTTTGGTGGGCACG GGG (reversed) Intergenic
No off target data available for this crispr