ID: 980564338

View in Genome Browser
Species Human (GRCh38)
Location 4:134518917-134518939
Sequence ATTCCTAGCTTCTGAATTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980564334_980564338 -3 Left 980564334 4:134518897-134518919 CCACCAAAGTGCCCTTAAAAATT No data
Right 980564338 4:134518917-134518939 ATTCCTAGCTTCTGAATTCTTGG No data
980564331_980564338 4 Left 980564331 4:134518890-134518912 CCCGTGCCCACCAAAGTGCCCTT No data
Right 980564338 4:134518917-134518939 ATTCCTAGCTTCTGAATTCTTGG No data
980564329_980564338 9 Left 980564329 4:134518885-134518907 CCAGCCCCGTGCCCACCAAAGTG No data
Right 980564338 4:134518917-134518939 ATTCCTAGCTTCTGAATTCTTGG No data
980564335_980564338 -6 Left 980564335 4:134518900-134518922 CCAAAGTGCCCTTAAAAATTCCT No data
Right 980564338 4:134518917-134518939 ATTCCTAGCTTCTGAATTCTTGG No data
980564327_980564338 11 Left 980564327 4:134518883-134518905 CCCCAGCCCCGTGCCCACCAAAG No data
Right 980564338 4:134518917-134518939 ATTCCTAGCTTCTGAATTCTTGG No data
980564332_980564338 3 Left 980564332 4:134518891-134518913 CCGTGCCCACCAAAGTGCCCTTA No data
Right 980564338 4:134518917-134518939 ATTCCTAGCTTCTGAATTCTTGG No data
980564326_980564338 17 Left 980564326 4:134518877-134518899 CCAGTTCCCCAGCCCCGTGCCCA No data
Right 980564338 4:134518917-134518939 ATTCCTAGCTTCTGAATTCTTGG No data
980564325_980564338 30 Left 980564325 4:134518864-134518886 CCAATCAATTGTTCCAGTTCCCC No data
Right 980564338 4:134518917-134518939 ATTCCTAGCTTCTGAATTCTTGG No data
980564330_980564338 5 Left 980564330 4:134518889-134518911 CCCCGTGCCCACCAAAGTGCCCT No data
Right 980564338 4:134518917-134518939 ATTCCTAGCTTCTGAATTCTTGG No data
980564328_980564338 10 Left 980564328 4:134518884-134518906 CCCAGCCCCGTGCCCACCAAAGT No data
Right 980564338 4:134518917-134518939 ATTCCTAGCTTCTGAATTCTTGG No data
980564333_980564338 -2 Left 980564333 4:134518896-134518918 CCCACCAAAGTGCCCTTAAAAAT No data
Right 980564338 4:134518917-134518939 ATTCCTAGCTTCTGAATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980564338 Original CRISPR ATTCCTAGCTTCTGAATTCT TGG Intergenic
No off target data available for this crispr