ID: 980567674

View in Genome Browser
Species Human (GRCh38)
Location 4:134565387-134565409
Sequence ACAAGTATGTGAAGCAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980567674_980567676 4 Left 980567674 4:134565387-134565409 CCTTCACTGCTTCACATACTTGT No data
Right 980567676 4:134565414-134565436 ACTTGGTACTGTCAATGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980567674 Original CRISPR ACAAGTATGTGAAGCAGTGA AGG (reversed) Intergenic
No off target data available for this crispr