ID: 980575925

View in Genome Browser
Species Human (GRCh38)
Location 4:134683072-134683094
Sequence CAGAGCAAAGAGCAGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980575922_980575925 3 Left 980575922 4:134683046-134683068 CCTGAGGCATAGGTGGATCTTTC No data
Right 980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980575925 Original CRISPR CAGAGCAAAGAGCAGGAGGA CGG Intergenic
No off target data available for this crispr