ID: 980586515

View in Genome Browser
Species Human (GRCh38)
Location 4:134823623-134823645
Sequence TAGAGAGCCACATGCGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980586515_980586518 1 Left 980586515 4:134823623-134823645 CCTTCCACGCATGTGGCTCTCTA No data
Right 980586518 4:134823647-134823669 CTTTTGAGCGCCGGCTTTTATGG No data
980586515_980586517 -8 Left 980586515 4:134823623-134823645 CCTTCCACGCATGTGGCTCTCTA No data
Right 980586517 4:134823638-134823660 GCTCTCTAACTTTTGAGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980586515 Original CRISPR TAGAGAGCCACATGCGTGGA AGG (reversed) Intergenic
No off target data available for this crispr