ID: 980594911

View in Genome Browser
Species Human (GRCh38)
Location 4:134941771-134941793
Sequence GTCAGCAAGCACTAAAAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980594903_980594911 20 Left 980594903 4:134941728-134941750 CCAAGAATGAGTGAGTATTATGA No data
Right 980594911 4:134941771-134941793 GTCAGCAAGCACTAAAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980594911 Original CRISPR GTCAGCAAGCACTAAAAGTG GGG Intergenic
No off target data available for this crispr