ID: 980600313

View in Genome Browser
Species Human (GRCh38)
Location 4:135015973-135015995
Sequence AAGGCTTCATGGGACCATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980600313_980600322 27 Left 980600313 4:135015973-135015995 CCCATATGGTCCCATGAAGCCTT No data
Right 980600322 4:135016023-135016045 GTTAGAGAAAAAAATCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980600313 Original CRISPR AAGGCTTCATGGGACCATAT GGG (reversed) Intergenic
No off target data available for this crispr