ID: 980601025

View in Genome Browser
Species Human (GRCh38)
Location 4:135024921-135024943
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980601025_980601031 19 Left 980601025 4:135024921-135024943 CCCTTCTTCATCTGATTAATCCC No data
Right 980601031 4:135024963-135024985 AGCCAAAATAGCACCATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980601025 Original CRISPR GGGATTAATCAGATGAAGAA GGG (reversed) Intergenic
No off target data available for this crispr