ID: 980602658

View in Genome Browser
Species Human (GRCh38)
Location 4:135045037-135045059
Sequence TACTCCTGGTTTACAGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980602658_980602662 22 Left 980602658 4:135045037-135045059 CCTGTGGCTGTAAACCAGGAGTA No data
Right 980602662 4:135045082-135045104 TATTGCATATATTTTAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980602658 Original CRISPR TACTCCTGGTTTACAGCCAC AGG (reversed) Intergenic
No off target data available for this crispr