ID: 980612291

View in Genome Browser
Species Human (GRCh38)
Location 4:135174567-135174589
Sequence CACGTTCCTCCTCTTTCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980612291_980612295 8 Left 980612291 4:135174567-135174589 CCAAAAGAAAGAGGAGGAACGTG No data
Right 980612295 4:135174598-135174620 AGGTACAATGCTTGTATATATGG 0: 23
1: 29
2: 18
3: 33
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980612291 Original CRISPR CACGTTCCTCCTCTTTCTTT TGG (reversed) Intergenic
No off target data available for this crispr