ID: 980613745

View in Genome Browser
Species Human (GRCh38)
Location 4:135192420-135192442
Sequence GAGCACACCCACAGTTATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980613742_980613745 -9 Left 980613742 4:135192406-135192428 CCAAAGACCACCAAGAGCACACC No data
Right 980613745 4:135192420-135192442 GAGCACACCCACAGTTATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980613745 Original CRISPR GAGCACACCCACAGTTATAC AGG Intergenic
No off target data available for this crispr