ID: 980614078

View in Genome Browser
Species Human (GRCh38)
Location 4:135195202-135195224
Sequence CCCACCAGGCCCCACCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980614078_980614088 -3 Left 980614078 4:135195202-135195224 CCCAGGAGGTGGGGCCTGGTGGG No data
Right 980614088 4:135195222-135195244 GGGAGGTGTTTGGGTCATGGGGG No data
980614078_980614089 16 Left 980614078 4:135195202-135195224 CCCAGGAGGTGGGGCCTGGTGGG No data
Right 980614089 4:135195241-135195263 GGGGCAAATCCCTGATAGCTTGG No data
980614078_980614086 -5 Left 980614078 4:135195202-135195224 CCCAGGAGGTGGGGCCTGGTGGG No data
Right 980614086 4:135195220-135195242 GTGGGAGGTGTTTGGGTCATGGG No data
980614078_980614087 -4 Left 980614078 4:135195202-135195224 CCCAGGAGGTGGGGCCTGGTGGG No data
Right 980614087 4:135195221-135195243 TGGGAGGTGTTTGGGTCATGGGG No data
980614078_980614085 -6 Left 980614078 4:135195202-135195224 CCCAGGAGGTGGGGCCTGGTGGG No data
Right 980614085 4:135195219-135195241 GGTGGGAGGTGTTTGGGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980614078 Original CRISPR CCCACCAGGCCCCACCTCCT GGG (reversed) Intergenic