ID: 980614085

View in Genome Browser
Species Human (GRCh38)
Location 4:135195219-135195241
Sequence GGTGGGAGGTGTTTGGGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20455
Summary {0: 300, 1: 1151, 2: 3915, 3: 6324, 4: 8765}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980614066_980614085 24 Left 980614066 4:135195172-135195194 CCATCCCTAATTCCATGTTGAAA No data
Right 980614085 4:135195219-135195241 GGTGGGAGGTGTTTGGGTCATGG 0: 300
1: 1151
2: 3915
3: 6324
4: 8765
980614067_980614085 20 Left 980614067 4:135195176-135195198 CCCTAATTCCATGTTGAAATATA No data
Right 980614085 4:135195219-135195241 GGTGGGAGGTGTTTGGGTCATGG 0: 300
1: 1151
2: 3915
3: 6324
4: 8765
980614076_980614085 -5 Left 980614076 4:135195201-135195223 CCCCAGGAGGTGGGGCCTGGTGG No data
Right 980614085 4:135195219-135195241 GGTGGGAGGTGTTTGGGTCATGG 0: 300
1: 1151
2: 3915
3: 6324
4: 8765
980614069_980614085 12 Left 980614069 4:135195184-135195206 CCATGTTGAAATATAATCCCCAG No data
Right 980614085 4:135195219-135195241 GGTGGGAGGTGTTTGGGTCATGG 0: 300
1: 1151
2: 3915
3: 6324
4: 8765
980614078_980614085 -6 Left 980614078 4:135195202-135195224 CCCAGGAGGTGGGGCCTGGTGGG No data
Right 980614085 4:135195219-135195241 GGTGGGAGGTGTTTGGGTCATGG 0: 300
1: 1151
2: 3915
3: 6324
4: 8765
980614080_980614085 -7 Left 980614080 4:135195203-135195225 CCAGGAGGTGGGGCCTGGTGGGA No data
Right 980614085 4:135195219-135195241 GGTGGGAGGTGTTTGGGTCATGG 0: 300
1: 1151
2: 3915
3: 6324
4: 8765
980614068_980614085 19 Left 980614068 4:135195177-135195199 CCTAATTCCATGTTGAAATATAA 0: 2
1: 9
2: 189
3: 1650
4: 5982
Right 980614085 4:135195219-135195241 GGTGGGAGGTGTTTGGGTCATGG 0: 300
1: 1151
2: 3915
3: 6324
4: 8765

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980614085 Original CRISPR GGTGGGAGGTGTTTGGGTCA TGG Intergenic
Too many off-targets to display for this crispr