ID: 980614086

View in Genome Browser
Species Human (GRCh38)
Location 4:135195220-135195242
Sequence GTGGGAGGTGTTTGGGTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21974
Summary {0: 432, 1: 1386, 2: 3977, 3: 6258, 4: 9921}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980614068_980614086 20 Left 980614068 4:135195177-135195199 CCTAATTCCATGTTGAAATATAA 0: 2
1: 9
2: 189
3: 1650
4: 5982
Right 980614086 4:135195220-135195242 GTGGGAGGTGTTTGGGTCATGGG 0: 432
1: 1386
2: 3977
3: 6258
4: 9921
980614080_980614086 -6 Left 980614080 4:135195203-135195225 CCAGGAGGTGGGGCCTGGTGGGA No data
Right 980614086 4:135195220-135195242 GTGGGAGGTGTTTGGGTCATGGG 0: 432
1: 1386
2: 3977
3: 6258
4: 9921
980614069_980614086 13 Left 980614069 4:135195184-135195206 CCATGTTGAAATATAATCCCCAG No data
Right 980614086 4:135195220-135195242 GTGGGAGGTGTTTGGGTCATGGG 0: 432
1: 1386
2: 3977
3: 6258
4: 9921
980614067_980614086 21 Left 980614067 4:135195176-135195198 CCCTAATTCCATGTTGAAATATA No data
Right 980614086 4:135195220-135195242 GTGGGAGGTGTTTGGGTCATGGG 0: 432
1: 1386
2: 3977
3: 6258
4: 9921
980614078_980614086 -5 Left 980614078 4:135195202-135195224 CCCAGGAGGTGGGGCCTGGTGGG No data
Right 980614086 4:135195220-135195242 GTGGGAGGTGTTTGGGTCATGGG 0: 432
1: 1386
2: 3977
3: 6258
4: 9921
980614076_980614086 -4 Left 980614076 4:135195201-135195223 CCCCAGGAGGTGGGGCCTGGTGG No data
Right 980614086 4:135195220-135195242 GTGGGAGGTGTTTGGGTCATGGG 0: 432
1: 1386
2: 3977
3: 6258
4: 9921
980614066_980614086 25 Left 980614066 4:135195172-135195194 CCATCCCTAATTCCATGTTGAAA No data
Right 980614086 4:135195220-135195242 GTGGGAGGTGTTTGGGTCATGGG 0: 432
1: 1386
2: 3977
3: 6258
4: 9921

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980614086 Original CRISPR GTGGGAGGTGTTTGGGTCAT GGG Intergenic
Too many off-targets to display for this crispr