ID: 980614087

View in Genome Browser
Species Human (GRCh38)
Location 4:135195221-135195243
Sequence TGGGAGGTGTTTGGGTCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26410
Summary {0: 521, 1: 1544, 2: 4567, 3: 7515, 4: 12263}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980614066_980614087 26 Left 980614066 4:135195172-135195194 CCATCCCTAATTCCATGTTGAAA No data
Right 980614087 4:135195221-135195243 TGGGAGGTGTTTGGGTCATGGGG 0: 521
1: 1544
2: 4567
3: 7515
4: 12263
980614080_980614087 -5 Left 980614080 4:135195203-135195225 CCAGGAGGTGGGGCCTGGTGGGA No data
Right 980614087 4:135195221-135195243 TGGGAGGTGTTTGGGTCATGGGG 0: 521
1: 1544
2: 4567
3: 7515
4: 12263
980614076_980614087 -3 Left 980614076 4:135195201-135195223 CCCCAGGAGGTGGGGCCTGGTGG No data
Right 980614087 4:135195221-135195243 TGGGAGGTGTTTGGGTCATGGGG 0: 521
1: 1544
2: 4567
3: 7515
4: 12263
980614067_980614087 22 Left 980614067 4:135195176-135195198 CCCTAATTCCATGTTGAAATATA No data
Right 980614087 4:135195221-135195243 TGGGAGGTGTTTGGGTCATGGGG 0: 521
1: 1544
2: 4567
3: 7515
4: 12263
980614078_980614087 -4 Left 980614078 4:135195202-135195224 CCCAGGAGGTGGGGCCTGGTGGG No data
Right 980614087 4:135195221-135195243 TGGGAGGTGTTTGGGTCATGGGG 0: 521
1: 1544
2: 4567
3: 7515
4: 12263
980614069_980614087 14 Left 980614069 4:135195184-135195206 CCATGTTGAAATATAATCCCCAG No data
Right 980614087 4:135195221-135195243 TGGGAGGTGTTTGGGTCATGGGG 0: 521
1: 1544
2: 4567
3: 7515
4: 12263
980614068_980614087 21 Left 980614068 4:135195177-135195199 CCTAATTCCATGTTGAAATATAA 0: 2
1: 9
2: 189
3: 1650
4: 5982
Right 980614087 4:135195221-135195243 TGGGAGGTGTTTGGGTCATGGGG 0: 521
1: 1544
2: 4567
3: 7515
4: 12263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980614087 Original CRISPR TGGGAGGTGTTTGGGTCATG GGG Intergenic
Too many off-targets to display for this crispr