ID: 980614088

View in Genome Browser
Species Human (GRCh38)
Location 4:135195222-135195244
Sequence GGGAGGTGTTTGGGTCATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 23121
Summary {0: 416, 1: 1270, 2: 3735, 3: 6486, 4: 11214}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980614080_980614088 -4 Left 980614080 4:135195203-135195225 CCAGGAGGTGGGGCCTGGTGGGA No data
Right 980614088 4:135195222-135195244 GGGAGGTGTTTGGGTCATGGGGG 0: 416
1: 1270
2: 3735
3: 6486
4: 11214
980614066_980614088 27 Left 980614066 4:135195172-135195194 CCATCCCTAATTCCATGTTGAAA No data
Right 980614088 4:135195222-135195244 GGGAGGTGTTTGGGTCATGGGGG 0: 416
1: 1270
2: 3735
3: 6486
4: 11214
980614067_980614088 23 Left 980614067 4:135195176-135195198 CCCTAATTCCATGTTGAAATATA No data
Right 980614088 4:135195222-135195244 GGGAGGTGTTTGGGTCATGGGGG 0: 416
1: 1270
2: 3735
3: 6486
4: 11214
980614068_980614088 22 Left 980614068 4:135195177-135195199 CCTAATTCCATGTTGAAATATAA 0: 2
1: 9
2: 189
3: 1650
4: 5982
Right 980614088 4:135195222-135195244 GGGAGGTGTTTGGGTCATGGGGG 0: 416
1: 1270
2: 3735
3: 6486
4: 11214
980614076_980614088 -2 Left 980614076 4:135195201-135195223 CCCCAGGAGGTGGGGCCTGGTGG No data
Right 980614088 4:135195222-135195244 GGGAGGTGTTTGGGTCATGGGGG 0: 416
1: 1270
2: 3735
3: 6486
4: 11214
980614069_980614088 15 Left 980614069 4:135195184-135195206 CCATGTTGAAATATAATCCCCAG No data
Right 980614088 4:135195222-135195244 GGGAGGTGTTTGGGTCATGGGGG 0: 416
1: 1270
2: 3735
3: 6486
4: 11214
980614078_980614088 -3 Left 980614078 4:135195202-135195224 CCCAGGAGGTGGGGCCTGGTGGG No data
Right 980614088 4:135195222-135195244 GGGAGGTGTTTGGGTCATGGGGG 0: 416
1: 1270
2: 3735
3: 6486
4: 11214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980614088 Original CRISPR GGGAGGTGTTTGGGTCATGG GGG Intergenic
Too many off-targets to display for this crispr