ID: 980614089

View in Genome Browser
Species Human (GRCh38)
Location 4:135195241-135195263
Sequence GGGGCAAATCCCTGATAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980614076_980614089 17 Left 980614076 4:135195201-135195223 CCCCAGGAGGTGGGGCCTGGTGG No data
Right 980614089 4:135195241-135195263 GGGGCAAATCCCTGATAGCTTGG No data
980614080_980614089 15 Left 980614080 4:135195203-135195225 CCAGGAGGTGGGGCCTGGTGGGA No data
Right 980614089 4:135195241-135195263 GGGGCAAATCCCTGATAGCTTGG No data
980614084_980614089 2 Left 980614084 4:135195216-135195238 CCTGGTGGGAGGTGTTTGGGTCA 0: 335
1: 1202
2: 3973
3: 6415
4: 11620
Right 980614089 4:135195241-135195263 GGGGCAAATCCCTGATAGCTTGG No data
980614078_980614089 16 Left 980614078 4:135195202-135195224 CCCAGGAGGTGGGGCCTGGTGGG No data
Right 980614089 4:135195241-135195263 GGGGCAAATCCCTGATAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980614089 Original CRISPR GGGGCAAATCCCTGATAGCT TGG Intergenic
No off target data available for this crispr