ID: 980615567

View in Genome Browser
Species Human (GRCh38)
Location 4:135219007-135219029
Sequence CTGTATATTAAAATGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980615567_980615569 24 Left 980615567 4:135219007-135219029 CCATGCTCCATTTTAATATACAG No data
Right 980615569 4:135219054-135219076 ATTTTTTCCCCTTTTTATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980615567 Original CRISPR CTGTATATTAAAATGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr