ID: 980617738

View in Genome Browser
Species Human (GRCh38)
Location 4:135253676-135253698
Sequence GACAGAAGAACATGAGCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980617738_980617741 6 Left 980617738 4:135253676-135253698 CCTTATGCTCATGTTCTTCTGTC No data
Right 980617741 4:135253705-135253727 GCTGAAATCCACAAGGCTATGGG No data
980617738_980617740 5 Left 980617738 4:135253676-135253698 CCTTATGCTCATGTTCTTCTGTC No data
Right 980617740 4:135253704-135253726 TGCTGAAATCCACAAGGCTATGG No data
980617738_980617739 -1 Left 980617738 4:135253676-135253698 CCTTATGCTCATGTTCTTCTGTC No data
Right 980617739 4:135253698-135253720 CTATGATGCTGAAATCCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980617738 Original CRISPR GACAGAAGAACATGAGCATA AGG (reversed) Intergenic
No off target data available for this crispr